ISIS 3521
Cancer Terms ->
Drugs and Chemicals ->
Pharmacologic Substance ->
Biological Agent ->
Antisense Agent -> ISIS 3521
ISIS 3521 Definition
A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. (NCI04)
ISIS 3521 Synonyms
ISIS 3521, Affinitac, Affinitak, CGP 64128A, DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A), DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA), LY900003, Protein Kinase C-Alpha Antisense
Terms in ISIS 3521 category
Copyright © Cancer Terms 2014 All rights reserved. | Terms of Use | Low Carb Foods
No reproduction or republication permitted.