Cancer Terms

ISIS 3521

Cancer Terms -> Drugs and Chemicals -> Pharmacologic Substance -> Biological Agent -> Antisense Agent -> ISIS 3521

ISIS 3521 Definition

A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. (NCI04)

ISIS 3521 Synonyms

ISIS 3521, Affinitac, Affinitak, CGP 64128A, DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A), DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA), LY900003, Protein Kinase C-Alpha Antisense

Terms in ISIS 3521 category



Copyright © Cancer Terms 2014 All rights reserved. | Terms of Use | Low Carb Foods

No reproduction or republication permitted.